Skip to main content

PresentER-MSIIFFLPL (GFP)
(Plasmid #102946)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102946 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PresentER
  • Backbone size w/o insert (bp) 8300
  • Total vector size (bp) 8311
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MSIIFFLPL
  • Alt name
    Pigment epithelium-derived factor H2-Kd epitope 257-264
  • Alt name
    PEDF 271–279
  • Alt name
    Serpinf1 271-279
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    27
  • GenBank ID
    NM_011340.3
  • Entrez Gene
    Serpinf1 (a.k.a. AI195227, EPC-1, Pedf, Pedfl, Sdf3)
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer GTTCGACCCCGCCTCGATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/09/22/267047 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PresentER-MSIIFFLPL (GFP) was a gift from David Scheinberg (Addgene plasmid # 102946 ; http://n2t.net/addgene:102946 ; RRID:Addgene_102946)
  • For your References section:

    Rejection of immunogenic tumor clones is limited by clonal fraction. Gejman RS, Chang AY, Jones HF, DiKun K, Hakimi AA, Schietinger A, Scheinberg DA. Elife. 2018 Nov 30;7. pii: 41090. doi: 10.7554/eLife.41090. 10.7554/eLife.41090 PubMed 30499773