Skip to main content

PresentER-NLVPMVATV (GFP)
(Plasmid #102947)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102947 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PresentER
  • Backbone size w/o insert (bp) 8300
  • Total vector size (bp) 8311
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLVPMVATV
  • Alt name
    CMV pp65 HLA-A*02:01 epitope 495-503
  • Alt name
    pp65 495-503
  • Species
    Synthetic; Cytomegalovirus
  • Insert Size (bp)
    27
  • GenBank ID
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer GTTCGACCCCGCCTCGATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/09/22/267047 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PresentER-NLVPMVATV (GFP) was a gift from David Scheinberg (Addgene plasmid # 102947 ; http://n2t.net/addgene:102947 ; RRID:Addgene_102947)
  • For your References section:

    Identification of the Targets of T-cell Receptor Therapeutic Agents and Cells by Use of a High-Throughput Genetic Platform. Gejman RS, Jones HF, Klatt MG, Chang AY, Oh CY, Chandran SS, Korontsvit T, Zakahleva V, Dao T, Klebanoff CA, Scheinberg DA. Cancer Immunol Res. 2020 May;8(5):672-684. doi: 10.1158/2326-6066.CIR-19-0745. Epub 2020 Mar 17. 10.1158/2326-6066.CIR-19-0745 PubMed 32184297