Skip to main content
Addgene

pLKO.1P shNFS1_1
(Plasmid #102963)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102963 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO_TRC005
  • Backbone manufacturer
    Broad Institute
  • Backbone size w/o insert (bp) 7466
  • Total vector size (bp) 7518
  • Vector type
    Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shNFS1_1
  • gRNA/shRNA sequence
    CAGTTCCAGAAAGGTATATTT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_021100
  • Entrez Gene
    NFS1 (a.k.a. COXPD52, HUSSY-08, IscS, NIFS)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCA TAT ACG ATA CAA GGC TGT TAG AG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The RNAi Consortium
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

TRCN0000229753

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1P shNFS1_1 was a gift from Richard Possemato (Addgene plasmid # 102963 ; http://n2t.net/addgene:102963 ; RRID:Addgene_102963)
  • For your References section:

    NFS1 undergoes positive selection in lung tumours and protects cells from ferroptosis. Alvarez SW, Sviderskiy VO, Terzi EM, Papagiannakopoulos T, Moreira AL, Adams S, Sabatini DM, Birsoy K, Possemato R. Nature. 2017 Nov 22. doi: 10.1038/nature24637. 10.1038/nature24637 PubMed 29168506