pLKO.1P shNFS1_1
(Plasmid
#102963)
-
PurposeSuppression of NFS1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO_TRC005
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 7466
- Total vector size (bp) 7518
-
Vector typeLentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshNFS1_1
-
gRNA/shRNA sequenceCAGTTCCAGAAAGGTATATTT
-
SpeciesH. sapiens (human)
-
GenBank IDNM_021100
-
Entrez GeneNFS1 (a.k.a. COXPD52, HUSSY-08, IscS, NIFS)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCA TAT ACG ATA CAA GGC TGT TAG AG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe RNAi Consortium
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TRCN0000229753
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1P shNFS1_1 was a gift from Richard Possemato (Addgene plasmid # 102963 ; http://n2t.net/addgene:102963 ; RRID:Addgene_102963) -
For your References section:
NFS1 undergoes positive selection in lung tumours and protects cells from ferroptosis. Alvarez SW, Sviderskiy VO, Terzi EM, Papagiannakopoulos T, Moreira AL, Adams S, Sabatini DM, Birsoy K, Possemato R. Nature. 2017 Nov 22. doi: 10.1038/nature24637. 10.1038/nature24637 PubMed 29168506