Skip to main content

pCAG-Cre-T2A-mRuby2
(Plasmid #102989)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102989 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Total vector size (bp) 6654
  • Vector type
    Mammalian Expression, Cre/Lox
  • Selectable markers
    mRuby2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cre (site-specific recombinase)
  • Alt name
    Cre recombinase
  • Species
    Bacteriophage P1
  • Insert Size (bp)
    1029
  • GenBank ID
    X03453
  • Promoter CAG

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer CCTCCCCGAGTTGCTG
  • 3′ sequencing primer CCGCATGTTAGAAGACTTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mRuby2
  • Species
    Synthetic
  • Insert Size (bp)
    711
  • GenBank ID
    AFR60232
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer TTCTAACATGCGGGGACG
  • 3′ sequencing primer GTGGTGGCTGGTGTGGCCAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Based on Addgene plasmid # 13775 by Connie Cepko. Only T2A and mRuby2 was inserted

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-Cre-T2A-mRuby2 was a gift from Karin Scharffetter-Kochanek (Addgene plasmid # 102989 ; http://n2t.net/addgene:102989 ; RRID:Addgene_102989)
  • For your References section:

    A model of the onset of the senescence associated secretory phenotype after DNA damage induced senescence. Meyer P, Maity P, Burkovski A, Schwab J, Mussel C, Singh K, Ferreira FF, Krug L, Maier HJ, Wlaschek M, Wirth T, Kestler HA, Scharffetter-Kochanek K. PLoS Comput Biol. 2017 Dec 4;13(12):e1005741. doi: 10.1371/journal.pcbi.1005741. eCollection 2017 Dec. 10.1371/journal.pcbi.1005741 PubMed 29206223