-
PurposeExpresses Cre and mRuby2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
- Total vector size (bp) 6654
-
Vector typeMammalian Expression, Cre/Lox
-
Selectable markersmRuby2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCre (site-specific recombinase)
-
Alt nameCre recombinase
-
SpeciesBacteriophage P1
-
Insert Size (bp)1029
-
GenBank IDX03453
- Promoter CAG
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CCTCCCCGAGTTGCTG
- 3′ sequencing primer CCGCATGTTAGAAGACTTCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemRuby2
-
SpeciesSynthetic
-
Insert Size (bp)711
-
GenBank IDAFR60232
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TTCTAACATGCGGGGACG
- 3′ sequencing primer GTGGTGGCTGGTGTGGCCAAT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Based on Addgene plasmid # 13775 by Connie Cepko. Only T2A and mRuby2 was inserted
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-Cre-T2A-mRuby2 was a gift from Karin Scharffetter-Kochanek (Addgene plasmid # 102989 ; http://n2t.net/addgene:102989 ; RRID:Addgene_102989) -
For your References section:
A model of the onset of the senescence associated secretory phenotype after DNA damage induced senescence. Meyer P, Maity P, Burkovski A, Schwab J, Mussel C, Singh K, Ferreira FF, Krug L, Maier HJ, Wlaschek M, Wirth T, Kestler HA, Scharffetter-Kochanek K. PLoS Comput Biol. 2017 Dec 4;13(12):e1005741. doi: 10.1371/journal.pcbi.1005741. eCollection 2017 Dec. 10.1371/journal.pcbi.1005741 PubMed 29206223