-
PurposeS. cerevisae centromic plasmid harboring Fncpf1 under control of TEF1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 103019 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep414TEF1
-
Backbone manufacturerMumberg D, et al. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 15
- Backbone size w/o insert (bp) 5416
- Total vector size (bp) 9466
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFncpf1
-
SpeciesFrancisella tularensis subsp. novicida U112
-
Insert Size (bp)4038
-
Mutationhuman codon optimized
-
GenBank IDCP000439.1
- Promoter TEF1
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- 3HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACAACTTTTTTTACTTCTTGCTCATTAGAAAGAAAGCATAGCAATCTAATCTAAGTTTTATGAGCATCTACCAGGAGTT
- 3′ sequencing primer TCCTTTTCGGTTAGAGCGGATGTGGGGGGAGGGCGTGAATGTAAGCGTGACATAACTAATTTAGGCATAGTCGGGGACAT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byZetsche et al., 2015, Cell 163, 759–771. http://dx.doi.org/10.1016/j.cell.2015.09.038
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUDC175 was a gift from Jean-Marc Daran (Addgene plasmid # 103019 ; http://n2t.net/addgene:103019 ; RRID:Addgene_103019) -
For your References section:
FnCpf1: a novel and efficient genome editing tool for Saccharomyces cerevisiae. Swiat MA, Dashko S, den Ridder M, Wijsman M, van der Oost J, Daran JM, Daran-Lapujade P. Nucleic Acids Res. 2017 Dec 1;45(21):12585-12598. doi: 10.1093/nar/gkx1007. 10.1093/nar/gkx1007 PubMed 29106617