Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUDE724
(Plasmid #103023)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 103023 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUD628
  • Backbone manufacturer
    Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR
  • Backbone size w/o insert (bp) 4995
  • Total vector size (bp) 5058
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    crPDR12-3.S
  • gRNA/shRNA sequence
    GCACAAAGAATCAATATGGGTGTCA
  • Species
    S. cerevisiae (budding yeast)
  • GenBank ID
    NM_001183872
  • Entrez Gene
    PDR12 (a.k.a. YPL058C)
  • Promoter SNR52

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUDE724 was a gift from Jean-Marc Daran (Addgene plasmid # 103023 ; http://n2t.net/addgene:103023 ; RRID:Addgene_103023)
  • For your References section:

    FnCpf1: a novel and efficient genome editing tool for Saccharomyces cerevisiae. Swiat MA, Dashko S, den Ridder M, Wijsman M, van der Oost J, Daran JM, Daran-Lapujade P. Nucleic Acids Res. 2017 Dec 1;45(21):12585-12598. doi: 10.1093/nar/gkx1007. 10.1093/nar/gkx1007 PubMed 29106617