-
PurposedPspCas13b-ADAR2DD(E488Q) fusion that can be used to selectively edit adenosine to inosine in RNA molecules when used in conjuction with a guide RNA.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 103849 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 9846
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePspCas13b
-
SpeciesPrevotella sp. P5-125
-
Insert Size (bp)3270
-
MutationChanged histidne 133 to alanine and histidine 1058 to alanine to remove RNAse activity.
-
GenBank IDWP_044065294
- Promoter CMV
-
Tag
/ Fusion Protein
- HIV NES (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehuADAR2DD
-
Alt namehuman ADAR2 deaminase domain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1158
-
MutationOnly the deaminase domain (AA 276-702 are expressed). Glutamate 488 is mutated to glutamine.
-
Entrez GeneADARB1 (a.k.a. ADAR2, DRABA2, DRADA2, NEDHYMS, RED1)
- Promoter CMV
-
Tag
/ Fusion Protein
- GS (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TGGGCAGCGACATCGTGTCCAAAGAGGAT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Benchling link: https://benchling.com/s/seq-arzpsupZEzGu3ghBDhtv
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC0039-CMV-dPspCas13b-GS-ADAR2DD(E488Q) was a gift from Feng Zhang (Addgene plasmid # 103849 ; http://n2t.net/addgene:103849 ; RRID:Addgene_103849) -
For your References section:
RNA editing with CRISPR-Cas13. Cox DBT, Gootenberg JS, Abudayyeh OO, Franklin B, Kellner MJ, Joung J, Zhang F. Science. 2017 Oct 25. pii: eaaq0180. doi: 10.1126/science.aaq0180. 10.1126/science.aaq0180 PubMed 29070703