-
Purpose(Empty Backbone) 3rd generation lentiviral plasmid for inducible expression of sgRNA; derived from tet-pLKO-puro; puromycin selection. See manual for detailed protocols.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104321 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonetet-pLKO-puro
- Backbone size (bp) 8800
-
Modifications to backboneshRNA encoding to sgRNA encoding
-
Vector typeMammalian Expression, Lentiviral, CRISPR
- Promoter H1/TO
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer tet-pLKO-seq-1: 5’- GTTTCAGACCCACCTCCCAAC’-3 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tet-pLKO-sgRNA-puro was a gift from Nathanael Gray (Addgene plasmid # 104321 ; http://n2t.net/addgene:104321 ; RRID:Addgene_104321) -
For your References section:
MELK is not necessary for the proliferation of basal-like breast cancer cells. Huang HT, Seo HS, Zhang T, Wang Y, Jiang B, Li Q, Buckley DL, Nabet B, Roberts JM, Paulk J, Dastjerdi S, Winter GE, McLauchlan H, Moran J, Bradner JE, Eck MJ, Dhe-Paganon S, Zhao JJ, Gray NS. eLife. 2017 Sep 19;6. pii: e26693. doi: 10.7554/eLife.26693. 10.7554/eLife.26693 PubMed 28926338