Skip to main content

pEGFP-N-Drd1
(Plasmid #104358)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104358 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6134
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dopamine receptor D1 (Drd1)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1434
  • Entrez Gene
    Drd1 (a.k.a. C030036C15Rik, Drd-1, Drd1a, Gpcr15)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho 1 (not destroyed)
  • 3′ cloning site Kpn1 (not destroyed)
  • 5′ sequencing primer CMV-F, CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N-Drd1 was a gift from Kirk Mykytyn (Addgene plasmid # 104358 ; http://n2t.net/addgene:104358 ; RRID:Addgene_104358)
  • For your References section:

    Dopamine receptor 1 localizes to neuronal cilia in a dynamic process that requires the Bardet-Biedl syndrome proteins. Domire JS, Green JA, Lee KG, Johnson AD, Askwith CC, Mykytyn K. Cell Mol Life Sci. 2011 Sep;68(17):2951-60. doi: 10.1007/s00018-010-0603-4. Epub 2010 Dec 9. 10.1007/s00018-010-0603-4 PubMed 21152952