-
PurposeExpresses mouse dopamine receptor subtype 1 with EGFP fused to the C-terminus of the receptor. Localizes to primary cilia.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104358 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6134
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDopamine receptor D1 (Drd1)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1434
-
Entrez GeneDrd1 (a.k.a. C030036C15Rik, Drd-1, Drd1a, Gpcr15)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho 1 (not destroyed)
- 3′ cloning site Kpn1 (not destroyed)
- 5′ sequencing primer CMV-F, CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-N-Drd1 was a gift from Kirk Mykytyn (Addgene plasmid # 104358 ; http://n2t.net/addgene:104358 ; RRID:Addgene_104358) -
For your References section:
Dopamine receptor 1 localizes to neuronal cilia in a dynamic process that requires the Bardet-Biedl syndrome proteins. Domire JS, Green JA, Lee KG, Johnson AD, Askwith CC, Mykytyn K. Cell Mol Life Sci. 2011 Sep;68(17):2951-60. doi: 10.1007/s00018-010-0603-4. Epub 2010 Dec 9. 10.1007/s00018-010-0603-4 PubMed 21152952