-
PurposeExpression of human VAP-B (mutant K87D/M89D, unable to bind FFAT motifs) fused to GFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104450 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 5506
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namevesicle-associated membrane protein-associated protein B
-
Alt nameVAP-B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)732
-
Mutationchanged K87 to D and M89 to D
-
GenBank IDNM_004738.3
-
Entrez GeneVAPB (a.k.a. ALS8, VAMP-B, VAP-B)
-
Tags
/ Fusion Proteins
- EGFP (N terminal on backbone)
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer GATCACATGGTCCTGCTG
- 3′ sequencing primer GAGGTTTTACTTGCTTTAAA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKentaro Hanada (VAP-B cDNA) Reference: Kawano M et al, J Biol Chem. 2006 Oct 6;281(40):30279-88. PMID: 16895911
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFPC1-hVAP-B KD/MD was a gift from Catherine Tomasetto (Addgene plasmid # 104450 ; http://n2t.net/addgene:104450 ; RRID:Addgene_104450) -
For your References section:
STARD3 or STARD3NL and VAP form a novel molecular tether between late endosomes and the ER. Alpy F, Rousseau A, Schwab Y, Legueux F, Stoll I, Wendling C, Spiegelhalter C, Kessler P, Mathelin C, Rio MC, Levine TP, Tomasetto C. J Cell Sci. 2013 Dec 1;126(Pt 23):5500-12. doi: 10.1242/jcs.139295. Epub 2013 Oct 8. 10.1242/jcs.139295 PubMed 24105263