Skip to main content
Addgene

pEGFPC1-hVAP-B KD/MD
(Plasmid #104450)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104450 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 5506
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    vesicle-associated membrane protein-associated protein B
  • Alt name
    VAP-B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    732
  • Mutation
    changed K87 to D and M89 to D
  • GenBank ID
    NM_004738.3
  • Entrez Gene
    VAPB (a.k.a. ALS8, VAMP-B, VAP-B)
  • Tags / Fusion Proteins
    • EGFP (N terminal on backbone)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer GATCACATGGTCCTGCTG
  • 3′ sequencing primer GAGGTTTTACTTGCTTTAAA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Kentaro Hanada (VAP-B cDNA) Reference: Kawano M et al, J Biol Chem. 2006 Oct 6;281(40):30279-88. PMID: 16895911
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFPC1-hVAP-B KD/MD was a gift from Catherine Tomasetto (Addgene plasmid # 104450 ; http://n2t.net/addgene:104450 ; RRID:Addgene_104450)
  • For your References section:

    STARD3 or STARD3NL and VAP form a novel molecular tether between late endosomes and the ER. Alpy F, Rousseau A, Schwab Y, Legueux F, Stoll I, Wendling C, Spiegelhalter C, Kessler P, Mathelin C, Rio MC, Levine TP, Tomasetto C. J Cell Sci. 2013 Dec 1;126(Pt 23):5500-12. doi: 10.1242/jcs.139295. Epub 2013 Oct 8. 10.1242/jcs.139295 PubMed 24105263