-
PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the Syn promoter
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104488 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
AAV1 | 104488-AAV1 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $437 | ||
AAV8 | 104488-AAV8 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $437 | ||
AAV9 | 104488-AAV9 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $437 | ||
AAV Retrograde | 104488-AAVrg | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | $437 | ||
AAV PHP.eB | 104488-PHPeB | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $437 |
Don’t see the serotype you want?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV-Syn
- Backbone size w/o insert (bp) 4579
- Total vector size (bp) 5932
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namejGCaMP7f
-
Alt nameGCaMP3-T302L R303P A317L D380Y
-
Alt nameGCaMP3 variant 921
-
Alt nameJanelia GCaMP7
-
SpeciesR. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
-
Insert Size (bp)1353
- Promoter Synapsin
-
Tag
/ Fusion Protein
- T7 epitope, Xpress tag, 6xHis
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ACCACGCGAGGCGCGAGATAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/434589v1 for bioRxiv preprint.
Information for AAV1 (Catalog # 104488-AAV1) ( Back to top)
Purpose
Ready-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP7f-WPRE (#104488). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7f-WPRE plasmid DNA.
Synapsin-driven GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $405 USD for preparation of 100 µL virus + $32 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Poloxamer 188
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Data submitted about 104488-AAV1 by requesting scientist(s):
Information for AAV8 (Catalog # 104488-AAV8) ( Back to top)
Purpose
Ready-to-use AAV8 particles produced from pGP-AAV-syn-jGCaMP7f-WPRE (#104488). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7f-WPRE plasmid DNA.
Synapsin-driven GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $405 USD for preparation of 100 µL virus + $32 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
- Buffer PBS + 0.001% Poloxamer 188
- Serotype AAV8
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV9 (Catalog # 104488-AAV9) ( Back to top)
Purpose
Ready-to-use AAV9 particles produced from pGP-AAV-syn-jGCaMP7f-WPRE (#104488). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7f-WPRE plasmid DNA.
Synapsin-driven GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $405 USD for preparation of 100 µL virus + $32 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
- Buffer PBS + 0.001% Poloxamer 188
- Serotype AAV9
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Data submitted about 104488-AAV9 by requesting scientist(s):
Information for AAV Retrograde (Catalog # 104488-AAVrg) ( Back to top)
Purpose
Ready-to-use AAV Retrograde particles produced from pGP-AAV-syn-jGCaMP7f-WPRE (#104488). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7f-WPRE plasmid DNA.
Synapsin-driven GCaMP7f calcium sensor. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $405 USD for preparation of 100 µL virus + $32 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
- Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
- Serotype AAV retrograde (AAVrg)
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.Data submitted about 104488-AAVrg by requesting scientist(s):
Information for AAV PHP.eB (Catalog # 104488-PHPeB) ( Back to top)
Purpose
Ready-to-use AAV PHP.eB particles produced from pGP-AAV-syn-jGCaMP7f-WPRE (#104488). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7f-WPRE plasmid DNA.
Synapsin-driven GCaMP7f calcium sensor. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $405 USD for preparation of 100 µL virus + $32 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
-
Packaging Plasmids
encode adenoviral helper sequences and AAV rep gene, PHP.eB cap gene
pUCmini-iCAP-PHP.eB (plasmid #103005) - Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
- Serotype PHPeB (plasmid #103005)
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Citation Information: When using the PHP.eB serotype in future publications, please acknowledge Viviana Gradinaru and cite Chan et al., Nat Neurosci, 20(8):1172-1179. Pubmed.These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGP-AAV-syn-jGCaMP7f-WPRE was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 104488 ; http://n2t.net/addgene:104488 ; RRID:Addgene_104488) For viral preps, please replace (Addgene plasmid # 104488) in the above sentence with: (Addgene viral prep # 104488-AAV1), (Addgene viral prep # 104488-AAV8), (Addgene viral prep # 104488-AAV9), (Addgene viral prep # 104488-AAVrg), or (Addgene viral prep # 104488-PHPeB) -
For your References section:
High-performance calcium sensors for imaging activity in neuronal populations and microcompartments. Dana H, Sun Y, Mohar B, Hulse BK, Kerlin AM, Hasseman JP, Tsegaye G, Tsang A, Wong A, Patel R, Macklin JJ, Chen Y, Konnerth A, Jayaraman V, Looger LL, Schreiter ER, Svoboda K, Kim DS. Nat Methods. 2019 Jul;16(7):649-657. doi: 10.1038/s41592-019-0435-6. Epub 2019 Jun 17. 10.1038/s41592-019-0435-6 PubMed 31209382