Skip to main content

OMM PKA Reporter
(Plasmid #104550)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104550 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEF1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 5736
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tom20 - mTurquoise2 - VASP 148-164
  • Alt name
    PKA reporter
  • Species
    Synthetic
  • Insert Size (bp)
    1005
  • Promoter EF1 alpha
  • Tag / Fusion Protein
    • mTurqouise2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGATCTCGAGCTCAAGCTTC
  • 3′ sequencing primer GTAACCATTATAAGCTGCAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    OMM PKA Reporter was a gift from David Lawrence (Addgene plasmid # 104550 ; http://n2t.net/addgene:104550 ; RRID:Addgene_104550)
  • For your References section:

    Design and Profiling of a Subcellular Targeted Optogenetic cAMP-Dependent Protein Kinase. O'Banion CP, Priestman MA, Hughes RM, Herring LE, Capuzzi SJ, Lawrence DS. Cell Chem Biol. 2017 Oct 25. pii: S2451-9456(17)30355-0. doi: 10.1016/j.chembiol.2017.09.011. 10.1016/j.chembiol.2017.09.011 PubMed 29104065