Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #104580)


Item Catalog # Description Quantity Price (USD)
Plasmid 104580 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Invitrogen (Thermo Fisher)
  • Backbone size w/o insert (bp) 10143
  • Total vector size (bp) 11244
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    250 rpm
  • Copy number
    High Copy


  • Gene/Insert name
    Mouse IgG2c CH1/CH2/CH3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer GCTTATAATGGTTACAAATAAAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS results found A157G, A163G, and A166G within the EBNA-1 translation on the pCEP4 backbone compared to YP_401677.1

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRVL-2 was a gift from Daniel Christ (Addgene plasmid # 104580 ; ; RRID:Addgene_104580)
  • For your References section:

    Expression of IgG Monoclonals with Engineered Immune Effector Functions. Vazquez-Lombardi R, Nevoltris D, Rouet R, Christ D. Methods Mol Biol. 2018;1827:313-334. doi: 10.1007/978-1-4939-8648-4_16. 10.1007/978-1-4939-8648-4_16 PubMed 30196504