Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRVL-5
(Plasmid #104583)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104583 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCEP4
  • Backbone manufacturer
    Invitrogen (Thermo Fisher)
  • Backbone size w/o insert (bp) 10143
  • Total vector size (bp) 11229
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    250 rpm
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human IgG1 CH1/CH2/CH3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1086
  • Entrez Gene
    IGHG1
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer GCTTATAATGGTTACAAATAAAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS results found A169G, A261G, A292G, and A295G within the EBNA1 translation on the pCEP4 backbone compared to YP_401677.1

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRVL-5 was a gift from Daniel Christ (Addgene plasmid # 104583 ; http://n2t.net/addgene:104583 ; RRID:Addgene_104583)
  • For your References section:

    Expression of IgG Monoclonals with Engineered Immune Effector Functions. Vazquez-Lombardi R, Nevoltris D, Rouet R, Christ D. Methods Mol Biol. 2018;1827:313-334. doi: 10.1007/978-1-4939-8648-4_16. 10.1007/978-1-4939-8648-4_16 PubMed 30196504