Skip to main content

pAAV-HDR-mEGFP-camk2a
(Plasmid #104589)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104589 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    PX551
  • Backbone size w/o insert (bp) 2905
  • Total vector size (bp) 5836
  • Vector type
    Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    calcium/calmodulin-dependent protein kinase II alpha
  • Alt name
    camk2a
  • gRNA/shRNA sequence
    ctgcctgcccagtgccagga
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Camk2a (a.k.a. CaMKII, mKIAA0968)
  • Promoter None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-HDR-mEGFP-camk2a was a gift from Ryohei Yasuda (Addgene plasmid # 104589 ; http://n2t.net/addgene:104589 ; RRID:Addgene_104589)
  • For your References section:

    Virus-Mediated Genome Editing via Homology-Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain. Nishiyama J, Mikuni T, Yasuda R. Neuron. 2017 Oct 18. pii: S0896-6273(17)30933-9. doi: 10.1016/j.neuron.2017.10.004. 10.1016/j.neuron.2017.10.004 PubMed 29056297