-
PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse camk2a
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104589 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonePX551
- Backbone size w/o insert (bp) 2905
- Total vector size (bp) 5836
-
Vector typeMouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecalcium/calmodulin-dependent protein kinase II alpha
-
Alt namecamk2a
-
gRNA/shRNA sequencectgcctgcccagtgccagga
-
SpeciesM. musculus (mouse)
-
Entrez GeneCamk2a (a.k.a. CaMKII, mKIAA0968)
- Promoter None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCA
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-HDR-mEGFP-camk2a was a gift from Ryohei Yasuda (Addgene plasmid # 104589 ; http://n2t.net/addgene:104589 ; RRID:Addgene_104589) -
For your References section:
Virus-Mediated Genome Editing via Homology-Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain. Nishiyama J, Mikuni T, Yasuda R. Neuron. 2017 Oct 18. pii: S0896-6273(17)30933-9. doi: 10.1016/j.neuron.2017.10.004. 10.1016/j.neuron.2017.10.004 PubMed 29056297