pJC-20xUAS-TALE1-VP64-P10
(Plasmid
#104606)
-
PurposeExpresses TALE1 under UAS control
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJC-TALE-VP64 (Plasmid #46147)
-
Backbone manufacturerDavid L. Stern
- Backbone size w/o insert (bp) 9851
- Total vector size (bp) 11806
-
Modifications to backboneGolden Gate assembled TALE1-array inserted between TAL-N' and TAL-C'
-
Vector typeInsect Expression, TALEN
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALE1
-
SpeciesSynthetic
-
Insert Size (bp)1955
- Promoter hsp70
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer AGCAGCAAGAGAAGATCAAACC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJC-20xUAS-TALE1-VP64-P10 was a gift from Tudor Fulga (Addgene plasmid # 104606 ; http://n2t.net/addgene:104606 ; RRID:Addgene_104606) -
For your References section:
A multiplexable TALE-based binary expression system for in vivo cellular interaction studies. Toegel M, Azzam G, Lee EY, Knapp DJHF, Tan Y, Fa M, Fulga TA. Nat Commun. 2017 Nov 21;8(1):1663. doi: 10.1038/s41467-017-01592-3. 10.1038/s41467-017-01592-3 PubMed 29162808