Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSC50
(Plasmid #104824)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104824 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSC218
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Glyma.08g081600, Glyma.05g126600
  • Alt name
    Hen1ab
  • gRNA/shRNA sequence
    aaagggatctctgaatgtaa, agtttcttgctacttctgaa

Cloning Information

  • Cloning method Gateway Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

112-277:1.2. Alternative name of plasmid: pSG218GG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSC50 was a gift from Robert Stupar (Addgene plasmid # 104824 ; http://n2t.net/addgene:104824 ; RRID:Addgene_104824)
  • For your References section:

    CRISPR/Cas9 and TALENs generate heritable mutations for genes involved in small RNA processing of Glycine max and Medicago truncatula. Curtin SJ, Xiong Y, Michno JM, Campbell BW, Stec AO, Cermak T, Starker C, Voytas DF, Eamens AL, Stupar RM. Plant Biotechnol J. 2017 Oct 31. doi: 10.1111/pbi.12857. 10.1111/pbi.12857 PubMed 29087011