pICH47742:PtFCP:Cas9YFP
(Plasmid
#104894)
-
PurposeCas9, with FCP promoter/terminator, Golden Gate Assembly, for Phaeodactylum transformation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104894 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICH47742
- Backbone size w/o insert (bp) 4968
- Total vector size (bp) 9731
-
Vector typeCRISPR ; ; Golden Gate Assembly
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)5382
-
Tag
/ Fusion Protein
- YFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ggataaaccttttcacgccc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCas9:YFP described in Hopes A, Nekrasov V, Kamoun S, Mock T. Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana. Phaeodactylum promoter and terminator from pPha-TI, described in Zaslavskaia L, Lippmeier C, Kroth P, Grossman A, Apt K. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. PtFCP promoter/terminator were domesticated by removing BpiI sites through site directed mutagenesis.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct was assembled using Golden Gate Cloning.
Please visit https://www.biorxiv.org/content/early/2018/10/17/444109 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICH47742:PtFCP:Cas9YFP was a gift from Thomas Mock (Addgene plasmid # 104894 ; http://n2t.net/addgene:104894 ; RRID:Addgene_104894) -
For your References section:
Biochemical Characterization of a Novel Redox-Regulated Metacaspase in a Marine Diatom. Graff van Creveld S, Ben-Dor S, Mizrachi A, Alcolombri U, Hopes A, Mock T, Rosenwasser S, Vardi A. Front Microbiol. 2021 Sep 8;12:688199. doi: 10.3389/fmicb.2021.688199. eCollection 2021. 10.3389/fmicb.2021.688199 PubMed 34566902