Skip to main content

Ypet-PBD
(Plasmid #105290)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105290 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEPet-C1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pak1
  • Alt name
    PAK1
  • Species
    H. sapiens (human)
  • Mutation
    aa encoding 65-150
  • Entrez Gene
    PAK1 (a.k.a. IDDMSSD, PAKalpha, alpha-PAK, p65-PAK)
  • Tag / Fusion Protein
    • Ypet (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Subcloned the sequence encoding amino acids 65-150 (with an additional nucleotide (C) added at the 5' end to keep it in frame) of human Pak1 into the EcoRI-BamH1 sites of pYPet-C1. The insert was from Dr. Natalie Lamarche-Vane (McGill University).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ypet-PBD was a gift from Kenneth Yamada (Addgene plasmid # 105290 ; http://n2t.net/addgene:105290 ; RRID:Addgene_105290)
  • For your References section:

    Nonpolarized signaling reveals two distinct modes of 3D cell migration. Petrie RJ, Gavara N, Chadwick RS, Yamada KM. J Cell Biol. 2012 Apr 30;197(3):439-55. doi: 10.1083/jcb.201201124. 10.1083/jcb.201201124 PubMed 22547408