Skip to main content

pEGFP Kind2 S159/181/666A
(Plasmid #105310)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105310 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-NV
  • Backbone manufacturer
    modified pEGFP-N1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kindlin2
  • Alt name
    FERMT2
  • Alt name
    fermitin family member 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2100
  • Mutation
    S159/181/666A
  • GenBank ID
    NM_006832
  • Entrez Gene
    FERMT2 (a.k.a. KIND2, MIG2, PLEKHC1, UNC112, UNC112B, mig-2)
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer GGGAAAAGAAGAGAACTTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutations in Kindlin2 were introduced by using site-directed mutagenesis (Stratagene)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP Kind2 S159/181/666A was a gift from Kenneth Yamada (Addgene plasmid # 105310 ; http://n2t.net/addgene:105310 ; RRID:Addgene_105310)
  • For your References section:

    Dense fibrillar collagen is a potent inducer of invadopodia via a specific signaling network. Artym VV, Swatkoski S, Matsumoto K, Campbell CB, Petrie RJ, Dimitriadis EK, Li X, Mueller SC, Bugge TH, Gucek M, Yamada KM. J Cell Biol. 2015 Feb 2;208(3):331-50. doi: 10.1083/jcb.201405099. 10.1083/jcb.201405099 PubMed 25646088