Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGP-AAV-CAG-FLEX-jGCaMP7c variant 1513-WPRE
(Plasmid #105323)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 105323 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 5027
  • Total vector size (bp) 6380
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
    jGCaMP7c variant 1513
  • Alt name
    GCaMP3-L59Q E60P T302L R303P M378G K379S D380Y T381R R392G T412N
  • Alt name
    GCaMP3 variant 1513
  • Alt name
    Janelia GCaMP7
  • Species
    R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CAG
  • Tag / Fusion Protein
    • T7 epitope, Xpress tag, 6xHis

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGP-AAV-CAG-FLEX-jGCaMP7c variant 1513-WPRE was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 105323 ; ; RRID:Addgene_105323)
  • For your References section:

    High-performance calcium sensors for imaging activity in neuronal populations and microcompartments. Dana H, Sun Y, Mohar B, Hulse BK, Kerlin AM, Hasseman JP, Tsegaye G, Tsang A, Wong A, Patel R, Macklin JJ, Chen Y, Konnerth A, Jayaraman V, Looger LL, Schreiter ER, Svoboda K, Kim DS. Nat Methods. 2019 Jul;16(7):649-657. doi: 10.1038/s41592-019-0435-6. Epub 2019 Jun 17. 10.1038/s41592-019-0435-6 PubMed 31209382