Skip to main content
Addgene

LRG-2.1T-neo-sgROSA
(Plasmid #105587)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105587 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LRG 2.1T(hU6-sgRNA- EFS-GFP-P2A-Neo)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA targeting rosa26 locus
  • gRNA/shRNA sequence
    GAAGATGGGCGGGAGTCTTC
  • Species
    M. musculus (mouse)
  • Promoter hU6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's sequencing found I2L and S177R in NeoR. These mutations are not known to affect neomycin selection.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LRG-2.1T-neo-sgROSA was a gift from Christopher Vakoc (Addgene plasmid # 105587 ; http://n2t.net/addgene:105587 ; RRID:Addgene_105587)
  • For your References section:

    A TFIID-SAGA Perturbation that Targets MYB and Suppresses Acute Myeloid Leukemia. Xu Y, Milazzo JP, Somerville TDD, Tarumoto Y, Huang YH, Ostrander EL, Wilkinson JE, Challen GA, Vakoc CR. Cancer Cell. 2018 Jan 8;33(1):13-28.e8. doi: 10.1016/j.ccell.2017.12.002. 10.1016/j.ccell.2017.12.002 PubMed 29316427