- 
            Purpose3rd generation lentiviral plasmid for expression of luciferase with Neo resistance
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105621 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneLentiV
- 
              Vector typeMammalian Expression, Lentiviral, Luciferase
- 
                Selectable markersNeomycin (select with G418)
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameLuciferase
- Promoter EFS
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AACCGGTGCCTAGAGAAGGT (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
- 
            
            
            Addgene Notes
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: Lenti-luciferase-P2A-Neo was a gift from Christopher Vakoc (Addgene plasmid # 105621 ; http://n2t.net/addgene:105621 ; RRID:Addgene_105621)
- 
                For your References section: A TFIID-SAGA Perturbation that Targets MYB and Suppresses Acute Myeloid Leukemia. Xu Y, Milazzo JP, Somerville TDD, Tarumoto Y, Huang YH, Ostrander EL, Wilkinson JE, Challen GA, Vakoc CR. Cancer Cell. 2018 Jan 8;33(1):13-28.e8. doi: 10.1016/j.ccell.2017.12.002. 10.1016/j.ccell.2017.12.002 PubMed 29316427
 
    
