-
PurposeUbiquitously expresses a secreted and fluorescently tagged Annexin5 for in-vivo apoptosis reporter
-
Depositing Lab
-
Depositing OrganizationPurdue University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105664 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 105664-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 105664-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneTol2-pDest
-
Backbone manufacturerGateway
- Backbone size w/o insert (bp) 11600
- Total vector size (bp) 13378
-
Modifications to backboneBeta-Actin 5' Promoter, PolyA 3'
-
Vector typeTol2-Gateway
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSecreted Annexin5-EYFP
-
Alt nameANXA5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1784
-
Entrez GeneANXA5 (a.k.a. ANX5, CPB-I, ENX2, HEL-S-7, PP4, RPRGL3, VAC-alph)
- Promoter Beta-Actin
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TATAGGGCGAATTGGGTACCGCCACCATGCATAAGGTTT
- 3′ sequencing primer ACCGCGGTGGCGGCCGCTTACTTGTACAGCTCGTCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 105664-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 105664-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tol2-BetaActin-SecA5-YFP was a gift from Qing Deng (Addgene plasmid # 105664 ; http://n2t.net/addgene:105664 ; RRID:Addgene_105664) -
For your References section:
Development and Characterization of an Endotoxemia Model in Zebra Fish. Hsu AY, Gurol T, Sobreira TJP, Zhang S, Moore N, Cai C, Zhang ZY, Deng Q. Front Immunol. 2018 Mar 29;9:607. doi: 10.3389/fimmu.2018.00607. eCollection 2018. 10.3389/fimmu.2018.00607 PubMed 29651289
Map uploaded by the depositor.
