-
PurposeUbiquitously expresses a secreted and fluorescently tagged Annexin5 for in-vivo apoptosis reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105664 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTol2-pDest
-
Backbone manufacturerGateway
- Backbone size w/o insert (bp) 11600
- Total vector size (bp) 13378
-
Modifications to backboneBeta-Actin 5' Promoter, PolyA 3'
-
Vector typeTol2-Gateway
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSecreted Annexin5-EYFP
-
Alt nameANXA5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1784
-
Entrez GeneANXA5 (a.k.a. ANX5, CPB-I, ENX2, HEL-S-7, PP4, RPRGL3, VAC-alph)
- Promoter Beta-Actin
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TATAGGGCGAATTGGGTACCGCCACCATGCATAAGGTTT
- 3′ sequencing primer ACCGCGGTGGCGGCCGCTTACTTGTACAGCTCGTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tol2-BetaActin-SecA5-YFP was a gift from Qing Deng (Addgene plasmid # 105664 ; http://n2t.net/addgene:105664 ; RRID:Addgene_105664) -
For your References section:
Development and Characterization of an Endotoxemia Model in Zebra Fish. Hsu AY, Gurol T, Sobreira TJP, Zhang S, Moore N, Cai C, Zhang ZY, Deng Q. Front Immunol. 2018 Mar 29;9:607. doi: 10.3389/fimmu.2018.00607. eCollection 2018. 10.3389/fimmu.2018.00607 PubMed 29651289