p70a-T7RNAP
(Plasmid #105683)

• Purpose: Expresses T7 polymerase in cell-free TXTL.
• Depositing Lab: Chase Beisel
• Publication: Maxwell et al Methods. 2018 Jul 1;143:48-57. doi: 10.1016/j.ymeth.2018.02.016. Epub 2018 Feb 24.

Backbone

• Vector backbone: pBEST-Luc
• Backbone manufacturer: Promega
• Total vector size (bp): 4486
• Modifications to backbone: pTacI promoter was removed and replaced by the bacteriophage Lambda promoter OR2-OR1-Pr, with one mutation made in this promoter. Untranslated region was removed and replaced by UTR1, a powerful UTR (see reference related to plasmid #40019) Luc gene (firefly Luciferase) was removed and replaced by T7 polymerase. A transcriptional terminator was added, called T500 (see reference related to plasmid #40019).
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): KL740
• Growth instructions: This plasmid should be grown at 29C, and not above 30C.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: T7 polymerase
• Alt name: T7 RNAP
• Insert Size (bp): 2687
• Promoter: OR2-OR1-Pr (bacteriophage Lambda with one mutation)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CCGCAGAGTGGATGTTTGACAT
• 3′ sequencing primer: gaaggttctctgagctaccaac

Resource Information

• Supplemental Documents:
  • P70a-T7RNAP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Strain KL740 (CGSC, https://cgsc.biology.yale.edu/Strain.php?ID=148712)

Addgene QC NGS analysis identified a few sequence discrepancies downstream of the insert sequence, relative to the sequence provided by the depositing laboratory. It is unknown what impact this may have on plasmid function.