pT7-7 asyn G51D
              
              
                (Plasmid
                
                #105747)
              
            
            
            
          - 
            PurposeBacterial expression of mutant human alpha synuclein
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105747 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepT7-7
 - 
              Vector typeBacterial Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert namealpha-synuclein G51D
 - 
                    SpeciesH. sapiens (human)
 - 
                  MutationG51D
 - 
                        Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
 - Promoter T7
 
Cloning Information
- Cloning method Unknown
 - 5′ sequencing primer T7 (TAATACGACTCACTATAGG)
 - 3′ sequencing primer AmpStop (TCAGGCAACTATGGATGAAC) (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pT7-7 asyn G51D was a gift from Hilal Lashuel (Addgene plasmid # 105747 ; http://n2t.net/addgene:105747 ; RRID:Addgene_105747) - 
                
For your References section:
The novel Parkinson's disease linked mutation G51D attenuates in vitro aggregation and membrane binding of alpha-synuclein, and enhances its secretion and nuclear localization in cells. Fares MB, Ait-Bouziad N, Dikiy I, Mbefo MK, Jovicic A, Kiely A, Holton JL, Lee SJ, Gitler AD, Eliezer D, Lashuel HA. Hum Mol Genet. 2014 Sep 1;23(17):4491-509. doi: 10.1093/hmg/ddu165. Epub 2014 Apr 11. 10.1093/hmg/ddu165 PubMed 24728187