Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBad-CA TAG233
(Plasmid #105838)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105838 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBad
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4100
  • Total vector size (bp) 4900
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    human carbonic anhydrase II thermostable variant
  • Alt name
    HCAII
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    801
  • Mutation
    TAG stop codon at site 233
  • Entrez Gene
    CA2 (a.k.a. CA-II, CAC, CAII, Car2, HEL-76, HEL-S-282)
  • Promoter pBad/arabinose
  • Tag / Fusion Protein
    • 6x his tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBad-CA TAG233 was a gift from Ryan Mehl (Addgene plasmid # 105838 ; http://n2t.net/addgene:105838 ; RRID:Addgene_105838)