px458_2A_GFP_sgRNA_TIA1
(Plasmid
#106097)
-
PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIA1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106097 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx458
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA TIA1
-
gRNA/shRNA sequenceAGTTTTTACAAGGTCCAATC
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px458_2A_GFP_sgRNA_TIA1 was a gift from Thomas Tuschl (Addgene plasmid # 106097 ; http://n2t.net/addgene:106097 ; RRID:Addgene_106097) -
For your References section:
The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Meyer C, Garzia A, Mazzola M, Gerstberger S, Molina H, Tuschl T. Mol Cell. 2018 Feb 15;69(4):622-635.e6. doi: 10.1016/j.molcel.2018.01.011. 10.1016/j.molcel.2018.01.011 PubMed 29429924