Skip to main content

pZLCv2-gMYOD1-3xFLAG-dCas9-HA-2xNLS
(Plasmid #106355)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106355 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZLCv2-3xFLAG-dCas9-HA-2xNLS
  • Backbone size w/o insert (bp) 13000
  • Total vector size (bp) 13103
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MYOD1 gRNA
  • gRNA/shRNA sequence
    AGGCATGGAGAGGTCTGAAA
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer gagggcctatttcccatgat
  • 3′ sequencing primer aacttctcggggactgtgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZLCv2-gMYOD1-3xFLAG-dCas9-HA-2xNLS was a gift from Stephen Tapscott (Addgene plasmid # 106355 ; http://n2t.net/addgene:106355 ; RRID:Addgene_106355)
  • For your References section:

    NuRD and CAF-1-mediated silencing of the D4Z4 array is modulated by DUX4-induced MBD3L proteins. Campbell AE, Shadle SC, Jagannathan S, Lim JW, Resnick R, Tawil R, van der Maarel SM, Tapscott SJ. Elife. 2018 Mar 13;7. pii: 31023. doi: 10.7554/eLife.31023. 10.7554/eLife.31023 PubMed 29533181