pSV40-GUS-P2A-Hygro
(Plasmid
#106480)
-
PurposeExpression of GUS and Hygromycin resistance gene from SV40 promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106480 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSV40
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3756
- Total vector size (bp) 5556
-
Vector typeMammalian Expression, Plant Expression
-
Selectable markersNeomycin (select with G418), Hygromycin ; GUS
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namebeta-glucuronidase
-
Alt nameGUS
-
Insert Size (bp)1809
- Promoter SV40 promoter
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tatttatgcagaggccgagg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHygromycin B resistance
-
SpeciesStreptomyces hygroscopicus
-
Insert Size (bp)1026
- Promoter SV40 promoter
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer tatttatgcagaggccgagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGUS gene cloned from the p2R3a-GUS-OcsT construct from Ari Pekka Mahonen Lab. (Addgene#71267)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSV40-GUS-P2A-Hygro was a gift from Alex Hewitt (Addgene plasmid # 106480 ; http://n2t.net/addgene:106480 ; RRID:Addgene_106480)