Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

gh148
(Plasmid #106818)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 106818 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    EPB104
  • Backbone manufacturer
    Eric-Paul Bennett (Addgene plasmid # 68369)
  • Backbone size w/o insert (bp) 2376
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KDELC2
  • gRNA/shRNA sequence
    GATTTGACTACGACTTTGAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    POGLUT3 (a.k.a. KDELC2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer T7NP
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gh148 was a gift from Eric-Paul Bennett (Addgene plasmid # 106818 ; http://n2t.net/addgene:106818 ; RRID:Addgene_106818)
  • For your References section:

    A validated gRNA library for CRISPR/Cas9 targeting of the human glycosyltransferase genome. Narimatsu Y, Joshi HJ, Zhang Y, Gomes C, Chen YH, Lorenzetti F, Furukawa S, Schjoldager K, Hansen L, Clausen H, Bennett EP, Wandall HH. Glycobiology. 2018 Jan 5. pii: 4791732. doi: 10.1093/glycob/cwx101. 10.1093/glycob/cwx101 PubMed 29315387