-
Purposesingle-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screen
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106965 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneCROPseq-Guide-EFS-SpCas9-P2A-puro
- Backbone size w/o insert (bp) 5280
- Total vector size (bp) 13704
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHypaSpCas9
-
SpeciesSynthetic; Streptococcus pyogenes
-
Insert Size (bp)4212
- Promoter EFS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGGGTTTGCCGCCAGAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byHypaSpCas9 cloned from BPK4410 plasmid (Addgene#101178) from Jennifer Doudna and Keith Joung labs. CROPseq-Guide-EFS-SpCas9-P2A-Puro backbone used to make this construct was originally derived from the CROPseq-Guide-Puro (Addgene#86708) from Christoph Bock Lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CROPseq-EFS-HypaSpCas9-P2A-puro was a gift from Alex Hewitt (Addgene plasmid # 106965 ; http://n2t.net/addgene:106965 ; RRID:Addgene_106965)