p2T-CAG-MCS-P2A-GFP-PuroR
(Plasmid
#107186)
-
Purpose(Empty Backbone) Base plasmid for cloning gene duplication alleles with eGFP reporter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107186 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonesgBbsI (p2Tol-U6-2xBbsI-sgRNA-HygR)
-
Backbone manufacturerRichard Sherwood Lab
- Backbone size (bp) 6059
-
Modifications to backboneThe sequence between Tol2 sites was replaced with a CAGGS promoter, multi-cloning site, P2A peptide sequence followed by eGFP sequence, and Puromycin resistance cassette.
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GAGGGCCTATTTCCCATGAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2T-CAG-MCS-P2A-GFP-PuroR was a gift from Richard Sherwood (Addgene plasmid # 107186 ; http://n2t.net/addgene:107186 ; RRID:Addgene_107186) -
For your References section:
Predictable and precise template-free CRISPR editing of pathogenic variants. Shen MW, Arbab M, Hsu JY, Worstell D, Culbertson SJ, Krabbe O, Cassa CA, Liu DR, Gifford DK, Sherwood RI. Nature. 2018 Nov;563(7733):646-651. doi: 10.1038/s41586-018-0686-x. Epub 2018 Nov 7. 10.1038/s41586-018-0686-x PubMed 30405244