p2T-CAG-SpCas9-BlastR
(Plasmid
#107190)
-
PurposeConfers constitutive expression of SpCas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonesgBbsI (p2Tol-U6-2xBbsI-sgRNA-HygR)
-
Backbone manufacturerRichard Sherwood Lab
- Backbone size w/o insert (bp) 6982
- Total vector size (bp) 12083
-
Modifications to backboneThe sequence between Tol2 sites was replaced with a CAGGS promoter, Cas9 sequence, and Blasticidin resistance cassette.
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9
-
Insert Size (bp)4101
-
Entrez GeneNEWENTRY
- Promoter Chicken ß-actin
-
Tag
/ Fusion Protein
- 3xFLAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MfeI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer CGAGGTCGACGGTATCG
- 3′ sequencing primer CAAGTTAACAACAACAATTGCATTCATTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2T-CAG-SpCas9-BlastR was a gift from Richard Sherwood (Addgene plasmid # 107190 ; http://n2t.net/addgene:107190 ; RRID:Addgene_107190) -
For your References section:
Predictable and precise template-free CRISPR editing of pathogenic variants. Shen MW, Arbab M, Hsu JY, Worstell D, Culbertson SJ, Krabbe O, Cassa CA, Liu DR, Gifford DK, Sherwood RI. Nature. 2018 Nov;563(7733):646-651. doi: 10.1038/s41586-018-0686-x. Epub 2018 Nov 7. 10.1038/s41586-018-0686-x PubMed 30405244