Skip to main content

p2T-CAG-SpCas9-BlastR
(Plasmid #107190)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107190 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 107190-D50 50 μg of DNA in Tris buffer $495
DNA 107190-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    sgBbsI (p2Tol-U6-2xBbsI-sgRNA-HygR)
  • Backbone manufacturer
    Richard Sherwood Lab
  • Backbone size w/o insert (bp) 6982
  • Total vector size (bp) 12083
  • Modifications to backbone
    The sequence between Tol2 sites was replaced with a CAGGS promoter, Cas9 sequence, and Blasticidin resistance cassette.
  • Vector type
    Mammalian Expression, Bacterial Expression, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Insert Size (bp)
    4101
  • Entrez Gene
    NEWENTRY
  • Promoter Chicken ß-actin
  • Tag / Fusion Protein
    • 3xFLAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MfeI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer CGAGGTCGACGGTATCG
  • 3′ sequencing primer CAAGTTAACAACAACAATTGCATTCATTTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2T-CAG-SpCas9-BlastR was a gift from Richard Sherwood (Addgene plasmid # 107190 ; http://n2t.net/addgene:107190 ; RRID:Addgene_107190)
  • For your References section:

    Predictable and precise template-free CRISPR editing of pathogenic variants. Shen MW, Arbab M, Hsu JY, Worstell D, Culbertson SJ, Krabbe O, Cassa CA, Liu DR, Gifford DK, Sherwood RI. Nature. 2018 Nov;563(7733):646-651. doi: 10.1038/s41586-018-0686-x. Epub 2018 Nov 7. 10.1038/s41586-018-0686-x PubMed 30405244