-
PurposeRNA motif plasmid with BoxB sites. Digest with BsmBI and insert RNA motif of interest. Stuffer size 1.8kb
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107253 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLEX
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRNA motif plasmid cloning backbone
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CAT GGT CCT GCT GGA GTT CGT G (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Digest plasmid with BsmBI and ligate RNA motif of interest. The RNA motif of interest would be in the 3UTR and flanked by BoxB motifs.
Oligo cloning can be performed similarly to sgRNA cloning. Primers to order:
Primers (5'->3')
F GCTT <RNA motif of interest>
R AGCT <Reverse complement RNA motif of interest>
Example to clone in motif IRE motif
IRE motif: TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA
Primers to order
F: GCTT TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA
R: AGCT TTATACATTATGGAAGACACTGCTCCCGATAATGTGTTA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RNA motif plasmid cloning backbone was a gift from Paul Khavari (Addgene plasmid # 107253 ; http://n2t.net/addgene:107253 ; RRID:Addgene_107253) -
For your References section:
RNA-protein interaction detection in living cells. Ramanathan M, Majzoub K, Rao DS, Neela PH, Zarnegar BJ, Mondal S, Roth JG, Gai H, Kovalski JR, Siprashvili Z, Palmer TD, Carette JE, Khavari PA. Nat Methods. 2018 Feb 5. pii: nmeth.4601. doi: 10.1038/nmeth.4601. 10.1038/nmeth.4601 PubMed 29400715