pBluescript_VEGFA-TS3_SpCas9
(Plasmid
#107328)
-
PurposeU6 driven SpCas9 sgRNA expression for VEGFA site 3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107328 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript
- Total vector size (bp) 3293
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVEGFA-TS3 sgRNA
-
gRNA/shRNA sequenceGGTGAGTGAGTGTGTGCGTG
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BfuAI (destroyed during cloning)
- 3′ cloning site BfuAI (destroyed during cloning)
- 5′ sequencing primer T3
- 3′ sequencing primer T7
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBluescript_VEGFA-TS3_SpCas9 was a gift from Scot Wolfe (Addgene plasmid # 107328 ; http://n2t.net/addgene:107328 ; RRID:Addgene_107328) -
For your References section:
Orthogonal Cas9-Cas9 chimeras provide a versatile platform for genome editing. Bolukbasi MF, Liu P, Luk K, Kwok SF, Gupta A, Amrani N, Sontheimer EJ, Zhu LJ, Wolfe SA. Nat Commun. 2018 Nov 19;9(1):4856. doi: 10.1038/s41467-018-07310-x. 10.1038/s41467-018-07310-x PubMed 30451839