pIBA3-SpyCatcher-sfGFP
(Plasmid
#107420)
-
PurposeFor production of SpyCatcher protein fused N-terminally to sfGFP. Includes N-terminal His tag for purification and C-terminal StrepII tag for detection.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107420 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepASK-IBA3
-
Backbone manufacturerIBA GmbH
- Backbone size w/o insert (bp) 3226
- Total vector size (bp) 4234
-
Modifications to backbonedeletion of residues 142-216
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSpyCatcher
-
SpeciesSynthetic
-
Insert Size (bp)1224
-
GenBank IDAFD50637
- Promoter Tet
-
Tags
/ Fusion Proteins
- His tag (N terminal on insert)
- superfolder GFP (C terminal on insert)
- StrepII (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGTTATTTTACCACTCCCT
- 3′ sequencing primer CGCAGTAGCGGTAAACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene (Mark Howarth lab)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Spycatcher was published in Zakeri et al. (2012), PNAS 109, ppE690-7
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIBA3-SpyCatcher-sfGFP was a gift from Jack Leo (Addgene plasmid # 107420 ; http://n2t.net/addgene:107420 ; RRID:Addgene_107420) -
For your References section:
Insights into the autotransport process of a trimeric autotransporter, Yersinia Adhesin A (YadA). Chauhan N, Hatlem D, Orwick-Rydmark M, Schneider K, Floetenmeyer M, van Rossum B, Leo JC, Linke D. Mol Microbiol. 2019 Jan 1. doi: 10.1111/mmi.14195. 10.1111/mmi.14195 PubMed 30600549