Skip to main content

cacnb1b (rat) in pMT2 vector
(Plasmid #107423)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107423 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMT2
  • Backbone manufacturer
    Genetics Institute, Inc, Cambridge, MA, USA
  • Backbone size w/o insert (bp) 5163
  • Total vector size (bp) 7734
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    calcium channel beta1b auxillary subunit
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2599
  • Promoter Ad MLP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
  • 3′ sequencing primer GGTCGAACCATGATGGCAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr Terry P. Snutch, The University of British Columbia, Vancouver, B.C., Canada
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note, although not a perfect match, the nucleotide sequence of this plasmid most closely matches NM_017346.1 Rattus norvegicus cacnb1 mRNA.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cacnb1b (rat) in pMT2 vector was a gift from Annette Dolphin (Addgene plasmid # 107423 ; http://n2t.net/addgene:107423 ; RRID:Addgene_107423)
  • For your References section:

    The intracellular loop between domains I and II of the B-type calcium channel confers aspects of G-protein sensitivity to the E-type calcium channel. Page KM, Stephens GJ, Berrow NS, Dolphin AC. J Neurosci. 1997 Feb 15;17(4):1330-8. PubMed 9006976