Skip to main content

cacnb4 (rat) in pMT2 vector
(Plasmid #107426)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107426 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMT2
  • Backbone manufacturer
    Genetics Institute, Inc, Cambridge, MA, USA
  • Backbone size w/o insert (bp) 5163
  • Total vector size (bp) 9114
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacnb4
  • Alt name
    calcium channel beta4 subunit
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3953
  • GenBank ID
    L02315
  • Entrez Gene
    Cacnb4 (a.k.a. CAB4)
  • Promoter Ad MLP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
  • 3′ sequencing primer GGTCGAACCATGATGGCAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr Edward Perez-Reyes,Stritch School of Medicine, Dept of Physiology, Loyola University Chicago, Illinois, USA
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We received it in pBluescript and subcloned it into pMT2 plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cacnb4 (rat) in pMT2 vector was a gift from Annette Dolphin (Addgene plasmid # 107426 ; http://n2t.net/addgene:107426 ; RRID:Addgene_107426)
  • For your References section:

    The ducky mutation in Cacna2d2 results in altered Purkinje cell morphology and is associated with the expression of a truncated alpha 2 delta-2 protein with abnormal function. Brodbeck J, Davies A, Courtney JM, Meir A, Balaguero N, Canti C, Moss FJ, Page KM, Pratt WS, Hunt SP, Barclay J, Rees M, Dolphin AC. J Biol Chem. 2002 Mar 8;277(10):7684-93. doi: 10.1074/jbc.M109404200. Epub 2001 Dec 26. 10.1074/jbc.M109404200 PubMed 11756448

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More