cacnb4 (rat) in pMT2 vector
(Plasmid
#107426)
-
PurposeExpresses Calcium channel beta4 auxillary subunit in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMT2
-
Backbone manufacturerGenetics Institute, Inc, Cambridge, MA, USA
- Backbone size w/o insert (bp) 5163
- Total vector size (bp) 9114
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacnb4
-
Alt namecalcium channel beta4 subunit
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3953
-
GenBank IDL02315
-
Entrez GeneCacnb4 (a.k.a. CAB4)
- Promoter Ad MLP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
- 3′ sequencing primer GGTCGAACCATGATGGCAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr Edward Perez-Reyes,Stritch School of Medicine, Dept of Physiology, Loyola University Chicago, Illinois, USA
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We received it in pBluescript and subcloned it into pMT2 plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cacnb4 (rat) in pMT2 vector was a gift from Annette Dolphin (Addgene plasmid # 107426 ; http://n2t.net/addgene:107426 ; RRID:Addgene_107426) -
For your References section:
The ducky mutation in Cacna2d2 results in altered Purkinje cell morphology and is associated with the expression of a truncated alpha 2 delta-2 protein with abnormal function. Brodbeck J, Davies A, Courtney JM, Meir A, Balaguero N, Canti C, Moss FJ, Page KM, Pratt WS, Hunt SP, Barclay J, Rees M, Dolphin AC. J Biol Chem. 2002 Mar 8;277(10):7684-93. doi: 10.1074/jbc.M109404200. Epub 2001 Dec 26. 10.1074/jbc.M109404200 PubMed 11756448