Skip to main content

pCW57.1 N-term GFP tTA
(Plasmid #107551)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107551 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    David Root
  • Backbone size (bp) 8234
  • Modifications to backbone
    tTA replacing rtTA for dox-repression, Blast selection marker replacing puro selection, and GFP inserted as an optional N-terminal tag.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin
  • Tag / Fusion Protein
    • GFP (optional) (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    XL10 gold can be used for propagation and may perform better for large scale culture for maxi prep.
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer AGCAGAGCTCGTTTAGTGAACC
  • 3′ sequencing primer CGAACGGACGTGAAGAATGTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

GFP can be used as an N-terminal tag, but the GFP can also be eliminated and used as a 'dropout' for cloning into the vector. NheI can be used to drop the GFP, and SalI can be used to keep GFP as an N-terminal tag. Its quite useful to have GFP as a tag as it can be used for localization, immunoprecipitation, and for Western Blotting.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1 N-term GFP tTA was a gift from David Sabatini (Addgene plasmid # 107551 ; http://n2t.net/addgene:107551 ; RRID:Addgene_107551)