-
Purpose(Empty Backbone) All-in-one dox-repressible expression of cDNA with optional N-term GFP tag.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerDavid Root
- Backbone size (bp) 8234
-
Modifications to backbonetTA replacing rtTA for dox-repression, Blast selection marker replacing puro selection, and GFP inserted as an optional N-terminal tag.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
-
Tag
/ Fusion Protein
- GFP (optional) (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsXL10 gold can be used for propagation and may perform better for large scale culture for maxi prep.
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer AGCAGAGCTCGTTTAGTGAACC
- 3′ sequencing primer CGAACGGACGTGAAGAATGTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GFP can be used as an N-terminal tag, but the GFP can also be eliminated and used as a 'dropout' for cloning into the vector. NheI can be used to drop the GFP, and SalI can be used to keep GFP as an N-terminal tag. Its quite useful to have GFP as a tag as it can be used for localization, immunoprecipitation, and for Western Blotting.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1 N-term GFP tTA was a gift from David Sabatini (Addgene plasmid # 107551 ; http://n2t.net/addgene:107551 ; RRID:Addgene_107551)