pTU1-A-pdh_RiboJ_mCherry_Bba_B0015
(Plasmid
#107581)
-
PurposeB. megaterium DSM319 pdh promoter, mCherry (Bacillus codon optimised) for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTU1-A - EcoFlex (Moore et al, 2016 - PubMed PMID: 27096716)
-
Backbone manufacturerN/A
- Backbone size w/o insert (bp) 5922
- Total vector size (bp) 6633
-
Modifications to backboneEcoFlex backbone (AmpR + pMB1) and Bacillus origin of replication (rebM) and tetracycline resistance (tetA)
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions100 ug/ml ampicillin in E. coli 5 ug/ml tetracycline in Bacillus
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter pdh promoter Bacillus megaterium DSM319
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site See Moore et al, 2016 - PubMed PMID: 27096716 (destroyed during cloning)
- 3′ cloning site EcoFlex assembly (destroyed during cloning)
- 5′ sequencing primer BM_VF; gctttcgctaaggatgatttctg
- 3′ sequencing primer BM_VR; cgaaagggcctcgtgatac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr Rebekka Biedendieck and Professor Dieter Jahn - Braunschweig Technical University
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
mCherry - 31% G+C% codon optimised for expression in Bacillus species
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTU1-A-pdh_RiboJ_mCherry_Bba_B0015 was a gift from Paul Freemont (Addgene plasmid # 107581 ; http://n2t.net/addgene:107581 ; RRID:Addgene_107581) -
For your References section:
Rapid acquisition and model-based analysis of cell-free transcription-translation reactions from nonmodel bacteria. Moore SJ, MacDonald JT, Wienecke S, Ishwarbhai A, Tsipa A, Aw R, Kylilis N, Bell DJ, McClymont DW, Jensen K, Polizzi KM, Biedendieck R, Freemont PS. Proc Natl Acad Sci U S A. 2018 Apr 17. pii: 1715806115. doi: 10.1073/pnas.1715806115. 10.1073/pnas.1715806115 PubMed 29666238