Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #107581)


Item Catalog # Description Quantity Price (USD)
Plasmid 107581 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pTU1-A - EcoFlex (Moore et al, 2016 - PubMed PMID: 27096716)
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5922
  • Total vector size (bp) 6633
  • Modifications to backbone
    EcoFlex backbone (AmpR + pMB1) and Bacillus origin of replication (rebM) and tetracycline resistance (tetA)
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    100 ug/ml ampicillin in E. coli 5 ug/ml tetracycline in Bacillus
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter pdh promoter Bacillus megaterium DSM319

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site See Moore et al, 2016 - PubMed PMID: 27096716 (destroyed during cloning)
  • 3′ cloning site EcoFlex assembly (destroyed during cloning)
  • 5′ sequencing primer BM_VF; gctttcgctaaggatgatttctg
  • 3′ sequencing primer BM_VR; cgaaagggcctcgtgatac
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Dr Rebekka Biedendieck and Professor Dieter Jahn - Braunschweig Technical University

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

mCherry - 31% G+C% codon optimised for expression in Bacillus species

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTU1-A-pdh_RiboJ_mCherry_Bba_B0015 was a gift from Paul Freemont (Addgene plasmid # 107581 ; ; RRID:Addgene_107581)
  • For your References section:

    Rapid acquisition and model-based analysis of cell-free transcription-translation reactions from nonmodel bacteria. Moore SJ, MacDonald JT, Wienecke S, Ishwarbhai A, Tsipa A, Aw R, Kylilis N, Bell DJ, McClymont DW, Jensen K, Polizzi KM, Biedendieck R, Freemont PS. Proc Natl Acad Sci U S A. 2018 Apr 17. pii: 1715806115. doi: 10.1073/pnas.1715806115. 10.1073/pnas.1715806115 PubMed 29666238