Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

YA1532: pAAV_ CAG-FLEX-paQuasAr3
(Plasmid #107702)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107702 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-CAG-FLEX
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6756
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    paQuasAr3
  • Species
    Synthetic
  • Insert Size (bp)
    1500

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtgcctcggtgtcgcccaga
  • 3′ sequencing primer aaggttccaatcagcatcagcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    YA1532: pAAV_ CAG-FLEX-paQuasAr3 was a gift from Adam Cohen (Addgene plasmid # 107702 ; http://n2t.net/addgene:107702 ; RRID:Addgene_107702)
  • For your References section:

    Voltage imaging and optogenetics reveal behaviour-dependent changes in hippocampal dynamics. Adam Y, Kim JJ, Lou S, Zhao Y, Xie ME, Brinks D, Wu H, Mostajo-Radji MA, Kheifets S, Parot V, Chettih S, Williams KJ, Gmeiner B, Farhi SL, Madisen L, Buchanan EK, Kinsella I, Zhou D, Paninski L, Harvey CD, Zeng H, Arlotta P, Campbell RE, Cohen AE. Nature. 2019 May 1. pii: 10.1038/s41586-019-1166-7. doi: 10.1038/s41586-019-1166-7. 10.1038/s41586-019-1166-7 PubMed 31043747