-
PurposeExpresses Cre recombinase for excising chromosomal loxP-Hyg-loxP cassette inserts.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCre-SacB-kan
-
Backbone manufacturerAdrie J.C. Steyn
- Backbone size w/o insert (bp) 8248
- Total vector size (bp) 8623
-
Modifications to backboneUsed E. coli recombineering to replace the kanamycin-resistant cassette with a zeocin-resistance cassette.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameble (Zeo resistance)
-
Insert Size (bp)375
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCGCAGACCGATACCAGGATCTTG
- 3′ sequencing primer CGGGGTGCACTCATCATAGTGCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEric Rubin, Harvard School of Public Health
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCre-SacB-zeo was a gift from Kenan Murphy (Addgene plasmid # 107706 ; http://n2t.net/addgene:107706 ; RRID:Addgene_107706) -
For your References section:
Mycobacterial recombineering. Murphy KC, Papavinasasundaram K, Sassetti CM. Methods Mol Biol. 2015;1285:177-99. doi: 10.1007/978-1-4939-2450-9_10. 10.1007/978-1-4939-2450-9_10 PubMed 25779316