-
PurposeExpression plasmid for 3xFLAG-tagged MGA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepN3-3xFlag
- Backbone size w/o insert (bp) 4063
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMGA
-
Alt nameMGAP
-
Alt nameMAX gene-associated protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)9362
-
Entrez GeneMGA (a.k.a. MAD5, MXD5)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFlag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CMV-for (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer SV40-pA-rev (CCTCACAAATGTGGTATGG) (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid encodes the 3115 amino acid full-length MGA isoform XP_005254303.1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN3-MGA was a gift from Guntram Suske (Addgene plasmid # 107715 ; http://n2t.net/addgene:107715 ; RRID:Addgene_107715) -
For your References section:
MGA, L3MBTL2 and E2F6 determine genomic binding of the non-canonical Polycomb repressive complex PRC1.6. Stielow B, Finkernagel F, Stiewe T, Nist A, Suske G. PLoS Genet. 2018 Jan 30;14(1):e1007193. doi: 10.1371/journal.pgen.1007193. 10.1371/journal.pgen.1007193 PubMed 29381691