Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pN3-MGA
(Plasmid #107715)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107715 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MGA
  • Alt name
    MGAP
  • Alt name
    MAX gene-associated protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    9362
  • Entrez Gene
    MGA (a.k.a. MAD5, MXD5)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFlag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CMV-for (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer SV40-pA-rev (CCTCACAAATGTGGTATGG)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

The plasmid encodes the 3115 amino acid full-length MGA isoform XP_005254303.1

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN3-MGA was a gift from Guntram Suske (Addgene plasmid # 107715 ; http://n2t.net/addgene:107715 ; RRID:Addgene_107715)
  • For your References section:

    MGA, L3MBTL2 and E2F6 determine genomic binding of the non-canonical Polycomb repressive complex PRC1.6. Stielow B, Finkernagel F, Stiewe T, Nist A, Suske G. PLoS Genet. 2018 Jan 30;14(1):e1007193. doi: 10.1371/journal.pgen.1007193. 10.1371/journal.pgen.1007193 PubMed 29381691