pSpCas9_BB_2A-GFP_MAPRE1-gRNA#3
(Plasmid #107728)

• Purpose: Knock out of EB1 in human cells by CRISPR/Cas9
• Depositing Lab: Torsten Wittmann
• Depositing Organization: University of California, San Francisco (UCSF)
  Located in United States of America
• Publication: van Haren et al Nat Cell Biol. 2018 Jan 29. pii: 10.1038/s41556-017-0028-5. doi: 10.1038/s41556-017-0028-5.
• Citations: 1 Article

Backbone

• Vector backbone: pSpCas9(BB)-2A-GFP (Addgene #48138)
• Backbone manufacturer: Feng Zhang Lab
• Backbone size w/o insert (bp): 9288
• Total vector size (bp): 9291
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MAPRE1 gRNA #3 (targets Exon 1)
• Alt name: EB1
• gRNA/shRNA sequence: ATGTCGACTTAGGTTATCAC
• Species: H. sapiens (human)
• GenBank ID: NM_012325.2
• Entrez Gene: MAPRE1 (a.k.a. EB1)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: ACGATACAAGGCTGTTAGAGAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For a detailed protocol on knocking out EB1 in human cell lines by CRISPR/Cas9, see our protocol on "Protocol Exchange" (doi and link can be found below)

For rapidly cloning gRNA sequences into pSpCAS9(BB)-2a-GFP in a single RE digestion/ ligation step, see support protocol 3

Generation of cell lines with light-controlled microtubule dynamics
Torsten Wittmann & Jeffrey van Haren
Protocol Exchange (2018) doi:10.1038/protex.2017.155
https://www.nature.com/protocolexchange/protocols/6427

DNA (Catalog # 107728-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 107728-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.