Skip to main content
Addgene

pDawn-sfGFP
(Plasmid #107741)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107741 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDawn
  • Backbone manufacturer
    Andreas Moeglich Lab
  • Backbone size w/o insert (bp) 7173
  • Total vector size (bp) 7917
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    superfolder GFP
  • Species
    Synthetic
  • Insert Size (bp)
    744
  • Promoter pLambda

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ctctggcggtgataatggttgc
  • 3′ sequencing primer GAGCCCCCGATTTAGAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Sebastian Schmidl, Jeff Tabor Lab
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDawn-sfGFP was a gift from Ingmar Riedel-Kruse (Addgene plasmid # 107741 ; http://n2t.net/addgene:107741 ; RRID:Addgene_107741)
  • For your References section:

    Biofilm Lithography enables high-resolution cell patterning via optogenetic adhesin expression. Jin X, Riedel-Kruse IH. Proc Natl Acad Sci U S A. 2018 Apr 3;115(14):3698-3703. doi: 10.1073/pnas.1720676115. Epub 2018 Mar 19. 10.1073/pnas.1720676115 PubMed 29555779