Skip to main content
Addgene

AAV pCAG-mRuby3-WPRE
(Plasmid #107744)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107744 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV pCAG-FLEX-tdTomato-WPRE (#51503)
  • Backbone manufacturer
    Hongkui Zeng/Allen Institute For Brain Science
  • Backbone size w/o insert (bp) 5396
  • Total vector size (bp) 6270
  • Modifications to backbone
    A fragment containing mRuby3 was swapped into replace tdTomato and the LoxP sites in the original backbone.
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mRuby3
  • Alt name
    monomeric ruby3
  • Alt name
    mRuby3 red fluorescent protein
  • Insert Size (bp)
    874
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer CCAGAGGTTGATTATCGATA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mRuby3 was synthesized de novo based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV pCAG-mRuby3-WPRE was a gift from Rylan Larsen (Addgene plasmid # 107744 ; http://n2t.net/addgene:107744 ; RRID:Addgene_107744)
  • For your References section:

    Laminar distribution and arbor density of two functional classes of thalamic inputs to primary visual cortex. Zhuang J, Wang Y, Ouellette ND, Turschak EE, Larsen RS, Takasaki KT, Daigle TL, Tasic B, Waters J, Zeng H, Reid RC. Cell Rep. 2021 Oct 12;37(2):109826. doi: 10.1016/j.celrep.2021.109826. 10.1016/j.celrep.2021.109826 PubMed 34644562