Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #80344)


Item Catalog # Description Quantity Price (USD)
Plasmid 80344 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 6842
  • Total vector size (bp) 7712
  • Modifications to backbone
    Contains Internal Ribosomal Entry Site (IRES) for expression of both TDsmURFP and eGFP.
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Tandem Dimer smURFP
  • Alt name
    Tandem Dimer small Ultra-Red Fluorescent Protein
  • Species
  • Insert Size (bp)
  • GenBank ID
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGCGTACAAGGGTACCGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Alt name
    enhanced Green Fluorescent Protein
  • Species
  • Insert Size (bp)
  • Promoter IRES

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer gtggctgcttatggtgacaatc
  • 3′ sequencing primer CCTCGACTGTGCCTTCTA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-TDsmURFP-IRES-eGFP was a gift from Erik Rodriguez & Roger Tsien (Addgene plasmid # 80344 ; ; RRID:Addgene_80344)
  • For your References section:

    A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein. Rodriguez EA, Tran GN, Gross LA, Crisp JL, Shu X, Lin JY, Tsien RY. Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935. 10.1038/nmeth.3935 PubMed 27479328